View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2242_high_8 (Length: 260)
Name: NF2242_high_8
Description: NF2242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2242_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 14 - 238
Target Start/End: Original strand, 15733206 - 15733430
Alignment:
| Q |
14 |
aatatcacaatgaaagaaaatacatagaaagagaaaataagtagagacatcgatcacacgtatgacaagcagcaatccctcatatgtagatgttcaatta |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||| |||||||| |
|
|
| T |
15733206 |
aatatcgcaatgaaagaaaatacatagaaagagaaaataagtagagacatcgatcacatgtatgacaagcatcaatccctgatatgtagatattcaatta |
15733305 |
T |
|
| Q |
114 |
ttagtaccatggtcgannnnnnnactgacatcgtcgaacactgtatagtgaggagggtcacgaaatggaattataatcaaacttcttatcactgaactga |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15733306 |
ttagtaccatggtcgatttttttactgacatcgtcgaatactgtatagtgaggagggtcacgaaatggaattataatcaaacttcttatcactgaactga |
15733405 |
T |
|
| Q |
214 |
actttgctttctccagttttgtggc |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
15733406 |
actttgctttctccagttttgtggc |
15733430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University