View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2242_low_9 (Length: 250)
Name: NF2242_low_9
Description: NF2242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2242_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 170 - 245
Target Start/End: Complemental strand, 12812044 - 12811969
Alignment:
| Q |
170 |
ccggcaggtaactttctcaaaaagaagaaatggtttgctcaagaaagcttatgaactgtctgttctctgtgctgct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12812044 |
ccggcaggtaactttctcaaaaagaagaaatggtttgctcaagaaagcttatgaactgtctgttctctgtgatgct |
12811969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 12812215 - 12812127
Alignment:
| Q |
1 |
tcatttctcactacaaaaatttatattctctctcnnnnnnn--ccatattgcactaaatcactataaataaagttagagtttatttctt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12812215 |
tcatttctcactacaaaaatttatattctctctttttttttttccatattgcactaaatcactataaataaagttagagtttatttctt |
12812127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 30642962 - 30642907
Alignment:
| Q |
179 |
aactttctcaaaaagaagaaatggtttgctcaagaaagcttatgaactgtctgttc |
234 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30642962 |
aactttctcaaagagaagaaatggtttgctcaaaaaagcttatgaactgtctgttc |
30642907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 5546365 - 5546428
Alignment:
| Q |
177 |
gtaactttctcaaaaagaagaaatggtttgctcaagaaagcttatgaactgtctgttctctgtg |
240 |
Q |
| |
|
|||||||||| |||||||||||||||||| | |||||||| |||||| | |||||||| |||| |
|
|
| T |
5546365 |
gtaactttctgcaaaagaagaaatggtttgttgaagaaagcatatgaattatctgttctttgtg |
5546428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 170 - 245
Target Start/End: Original strand, 28470206 - 28470281
Alignment:
| Q |
170 |
ccggcaggtaactttctcaaaaagaagaaatggtttgctcaagaaagcttatgaactgtctgttctctgtgctgct |
245 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||| || ||||| |||||||| || ||||| |||| |||| |
|
|
| T |
28470206 |
ccggcaagttactttctcaaaaagaagaaatggtttgctgaaaaaagcctatgaactctcagttctatgtgatgct |
28470281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 192 - 245
Target Start/End: Original strand, 5230011 - 5230064
Alignment:
| Q |
192 |
agaagaaatggtttgctcaagaaagcttatgaactgtctgttctctgtgctgct |
245 |
Q |
| |
|
|||||||||||| | || ||||||||||||||||| |||||||| |||| |||| |
|
|
| T |
5230011 |
agaagaaatggtcttcttaagaaagcttatgaactttctgttctttgtgatgct |
5230064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 174 - 235
Target Start/End: Complemental strand, 47271190 - 47271129
Alignment:
| Q |
174 |
caggtaactttctcaaaaagaagaaatggtttgctcaagaaagcttatgaactgtctgttct |
235 |
Q |
| |
|
||||| ||||||||||| ||||| |||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
47271190 |
caggttactttctcaaagagaaggaatggtttaatcaagaaagcttatgaactttctgttct |
47271129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University