View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2243_high_1 (Length: 461)
Name: NF2243_high_1
Description: NF2243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2243_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 187 - 447
Target Start/End: Complemental strand, 27791900 - 27791642
Alignment:
| Q |
187 |
catcctcaatttttggatctaaatcgggcttatgtgctgaatgcatgaatgcagcaaatttgtgactgcagcgaatctgatgtgtaattaacaatgtgtg |
286 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27791900 |
catcctcaatttttggatctagatcaggcttatgtgctgaatgcatgaatgtggcaaatttgtgactgcagcgaatctgatgtgtaattaacaatgtgtg |
27791801 |
T |
|
| Q |
287 |
tggggttctaaaacaagtttggtttcttttaggtgagttgccacatttcaggtgctgattctgcacttgtccaactgatcatgtcaaaagctttttcatg |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27791800 |
--gggttctaaaacaagtttggtttcttttaggtgagttgccacatttcaggtgctgattctgcacttgtccaactgatcatgtcaaaagctttttcatg |
27791703 |
T |
|
| Q |
387 |
ctttggatttgcacgttttttgctggtcctgtgccgtagctaagctttgaagtttgtattg |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27791702 |
ctttggatttgcacgttttttgctggtcctgtgccgtagctaagctttgaagtttgtattg |
27791642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 136; E-Value: 9e-71
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 27792031 - 27791876
Alignment:
| Q |
1 |
ggatgtactaactaatttagccttgctttcacatctagtggaactcttctgtcacagatgtaaagcttaactttactgtcatgcccaggattccctgcag |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27792031 |
ggatgtactaactaatttatccttgctttcacatctagtggaactcttctgccccagatgtaaagcttaactttactgtcatgcccaggattccctgcag |
27791932 |
T |
|
| Q |
101 |
tcccaaatttgccgcattcatgcatatggcacatcctcaatttttggatctagatc |
156 |
Q |
| |
|
|| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27791931 |
tcacaaatttgccgtattcatgcatatggcacatcctcaatttttggatctagatc |
27791876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University