View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2244_high_6 (Length: 397)
Name: NF2244_high_6
Description: NF2244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2244_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 13 - 384
Target Start/End: Complemental strand, 41698055 - 41697684
Alignment:
| Q |
13 |
tacttattaatttcaagaaggaaattcttgcatttgttccgaaagaaggattgaaaagtttagaagatgattcctcaaacgagtgttctacagttcttgt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41698055 |
tacttattaatttcaagaaggaaattcttgcatttgttccgaaagaaggattgaaaagtttagaagatgattcctcaaatgagtgttctacagttcttgt |
41697956 |
T |
|
| Q |
113 |
tgttgatgaatctatggcaattgcagcacacaatgaggatgcaaatgttgttcttgttggtcacacgtaagcgtttgtattcatattcatattttgttct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697955 |
tgttgatgaatctatggcaattgcagcacacaatgaggatgcaaatgttgttcttgttggtcacacgtaagcgtttgtattcatattcatattttgttct |
41697856 |
T |
|
| Q |
213 |
cgaattcaaataaaattgctttataagtattctttccttttttggtctttatgttatgcagctacttaattaaaggaagattgccaaatgggctattctt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41697855 |
cgaattcaaataaaattgctttataagtattctttccttttttggtctttatgttatgcagctacttaattaaaggaatattgccaaatgggctattctt |
41697756 |
T |
|
| Q |
313 |
tgttgcttatacatatgctggggagcttccaagctctgcatttgcatttaatagcaatggattggtaaaaat |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697755 |
tgttgcttatacatatgctggggagcttccaagctctgcatttgcatttaatagcaatggattggtaaaaat |
41697684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University