View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2244_low_21 (Length: 230)

Name: NF2244_low_21
Description: NF2244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2244_low_21
NF2244_low_21
[»] chr7 (1 HSPs)
chr7 (61-211)||(42342606-42342756)


Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 61 - 211
Target Start/End: Complemental strand, 42342756 - 42342606
Alignment:
61 gactggttttgactttagtatattcttcttggttcttgatctgcatcatgtgcacttttctcagttttaactacacaagaagatgcacttatgcatcaag 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42342756 gactggttttgactttagtatattcttcttggttcttgatctgcatcatgtgcacttttctcagttttaactacacaagaagatgcacttatgcatcaag 42342657  T
161 gatttcactctttaccatgtgatgttttcttcacagatgacaacttgtatt 211  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||    
42342656 gatttcactctctaccatgtgatgttttcttcacagatgacaacttgtatt 42342606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University