View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2244_low_21 (Length: 230)
Name: NF2244_low_21
Description: NF2244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2244_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 61 - 211
Target Start/End: Complemental strand, 42342756 - 42342606
Alignment:
| Q |
61 |
gactggttttgactttagtatattcttcttggttcttgatctgcatcatgtgcacttttctcagttttaactacacaagaagatgcacttatgcatcaag |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42342756 |
gactggttttgactttagtatattcttcttggttcttgatctgcatcatgtgcacttttctcagttttaactacacaagaagatgcacttatgcatcaag |
42342657 |
T |
 |
| Q |
161 |
gatttcactctttaccatgtgatgttttcttcacagatgacaacttgtatt |
211 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42342656 |
gatttcactctctaccatgtgatgttttcttcacagatgacaacttgtatt |
42342606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University