View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2244_low_23 (Length: 201)
Name: NF2244_low_23
Description: NF2244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2244_low_23 |
 | |
|
| [»] scaffold0363 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 4203249 - 4203068
Alignment:
| Q |
1 |
tttttggaaccttaggatgtgtcctgaagtagtgaatcttccnnnnnnnggagtgatcaatgaagaagagaatcatggaaaaattgctatgatggagagt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4203249 |
tttttggaatcttaggatgtgtcctgaagtagtgaatcttccaaaaaaaggagtgatcactgaagaagagaatcatggaaaaattgctatgatggagagt |
4203150 |
T |
|
| Q |
101 |
gaagaaaatggtgtgtatggttctgagtatagagtttgtcaagattgtggtaatagggctaagaaagattgtgtgtttagaa |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4203149 |
gaagaaaatggtgtgtatggttctgagtatagagtgtgtcaagattgtggtaatagggctaagaaagattgtgtgtttagaa |
4203068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0363 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0363
Description:
Target: scaffold0363; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 172
Target Start/End: Complemental strand, 17082 - 17034
Alignment:
| Q |
124 |
tgagtatagagtttgtcaagattgtggtaatagggctaagaaagattgt |
172 |
Q |
| |
|
||||| ||| ||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
17082 |
tgagtttagggtttgtcaagattgtggaaatagagctaagaaagattgt |
17034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 172
Target Start/End: Original strand, 14512731 - 14512779
Alignment:
| Q |
124 |
tgagtatagagtttgtcaagattgtggtaatagggctaagaaagattgt |
172 |
Q |
| |
|
||||| ||| ||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
14512731 |
tgagtttagggtttgtcaagattgtggaaatagagctaagaaagattgt |
14512779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University