View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2246_high_12 (Length: 257)
Name: NF2246_high_12
Description: NF2246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2246_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 103 - 242
Target Start/End: Original strand, 45598720 - 45598859
Alignment:
| Q |
103 |
gaatgttatgtgctattgccaccttgatgtggacggtttctttatatatctgaatatttatttcacgatgatcacttcagtcgagtaattcctttagcat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45598720 |
gaatgttatgtgctattgccaccttgatgtggacggtttctttatatatctgaatatttatttcacgatgatcacttcagtcgagtaattccttttgcat |
45598819 |
T |
 |
| Q |
203 |
aactgactcctcttttaatgcttcctactacttctaagat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45598820 |
aactgactcctcttttaatgcttcctactacttctaagat |
45598859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 45598618 - 45598679
Alignment:
| Q |
1 |
ggactctcggagtgctcatgtttggaacgaggatgatgatgagtatttaaatgaaacgatga |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45598618 |
ggactctcggagtgctcatgtttggaacgaggatgatgatgagtatttaaatgaaacaatga |
45598679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University