View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2246_low_16 (Length: 255)
Name: NF2246_low_16
Description: NF2246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2246_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 8010100 - 8010345
Alignment:
| Q |
1 |
aatatggatttcgacttagtgaggggagcggaagtttggatcccatattgtatcctattataggaggtggaaactcacacttgagaggtagatttttggg |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
8010100 |
aatatggatttcgacttggtgaggggagcggaagtttggatcccatattgtatcctattataggaggtggaaattcacatttgagaggtagatttttgga |
8010199 |
T |
|
| Q |
101 |
tttaaagtgtgagtggttaagtcataggccgcatatgaataagtaaaatgtttgaggttatccatatatctaatgccttaaaattttggatggatatgtg |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
8010200 |
tttaaagtgtgaacggttaagtcataggccgcatatgaataagtaaaatgtttgaggttatccatatacctaatgccttaaaattttggatggatgtgtg |
8010299 |
T |
|
| Q |
201 |
gtgtctcactttcttatggtcctggagcattaaccctttgcttctc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8010300 |
gtgtctcactttcttatggtcctggagcattaaccctttgtttctc |
8010345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 232
Target Start/End: Complemental strand, 28296115 - 28296045
Alignment:
| Q |
162 |
ccatatatctaatgccttaaaattttggatggatatgtggtgtctcactttcttatggtcctggagcatta |
232 |
Q |
| |
|
||||||| ||||| ||||| |||||| |||| |||||||||||| || |||| |||||||||||||||| |
|
|
| T |
28296115 |
ccatatacctaatctcttaaggttttgggtggagatgtggtgtctccctctcttgtggtcctggagcatta |
28296045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 164 - 205
Target Start/End: Original strand, 9048702 - 9048743
Alignment:
| Q |
164 |
atatatctaatgccttaaaattttggatggatatgtggtgtc |
205 |
Q |
| |
|
|||||||||||||||||| |||||||||| | |||||||||| |
|
|
| T |
9048702 |
atatatctaatgccttaagattttggatgaagatgtggtgtc |
9048743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 23161985 - 23162038
Alignment:
| Q |
173 |
atgccttaaaattttggatggatatgtggtgtctcactttcttatggtcctgga |
226 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||| | | ||||||||||||||||| |
|
|
| T |
23161985 |
atgccttaagattttgggtggagatgtggtgtttaattttcttatggtcctgga |
23162038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 224
Target Start/End: Complemental strand, 4685949 - 4685897
Alignment:
| Q |
172 |
aatgccttaaaattttggatggatatgtggtgtctcactttcttatggtcctg |
224 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||||||| |||| |||||||| |
|
|
| T |
4685949 |
aatgccttcaagttttggatggggatgtggtgtctcactctcttgtggtcctg |
4685897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University