View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2246_low_17 (Length: 250)
Name: NF2246_low_17
Description: NF2246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2246_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 35419320 - 35419079
Alignment:
| Q |
1 |
acacatcatgattccaatcatagattgtaatatatttcatagatttaaattgagatatttgagtccacccaaaattaacatcaaagagaatcgaatttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||| |
|
|
| T |
35419320 |
acacatcatgattccaatcatagattataacatattttatagatttaaattgagatatttgagtccacccaaaattaatatcaaggagaatcgaatatga |
35419221 |
T |
 |
| Q |
101 |
aacatc--gaaggagcacactcccaaatttaaaacc-aaaaccatgatgcgacccaagtgggttactagctagtaactattcctaattaccttgtatcat |
197 |
Q |
| |
|
||| || ||||||||||||| ||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35419220 |
aacctcaagaaggagcacactttcaaatctaaaaccaaaaaccatggtgcgacccaagtgggttactagctagtaactattcctaattaccttgta-cta |
35419122 |
T |
 |
| Q |
198 |
aaagtataaagtataaagaagtgttatttcacatcgacctttg |
240 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35419121 |
ctatcataaagtataaagaagtgttgtttcacatcgacctttg |
35419079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University