View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2246_low_21 (Length: 202)
Name: NF2246_low_21
Description: NF2246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2246_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 14 - 181
Target Start/End: Complemental strand, 4191915 - 4191748
Alignment:
| Q |
14 |
gatgaagattgaaatatataaatttacgctaatagcttaaataataagaaaaaacttgttttcaatttggattgtctgatactaattatacggtcaaatc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4191915 |
gatgaagattgaaatatataaatttacgctaatagcttaaataataagaaaaaacttgttttcaatttggatcgtctgatactaattatacggtcaaatc |
4191816 |
T |
|
| Q |
114 |
tcatttgactacatgacttcatgcaatttcgaccgcatactaatcagatctcagttgaatgcttaggt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4191815 |
tcatttgactacatgacttcatgcaatttcgaccgcatactaatcagatctcagttgaatgcttaggt |
4191748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University