View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2247_low_15 (Length: 238)
Name: NF2247_low_15
Description: NF2247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2247_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 172 - 222
Target Start/End: Complemental strand, 51540904 - 51540854
Alignment:
| Q |
172 |
cttagagagtggtttcggccattgttggtgttttctgccattgttgttgag |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51540904 |
cttagagagtggtttcggccattgttggtgttttctgccattgttgttgag |
51540854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 67 - 99
Target Start/End: Complemental strand, 51541009 - 51540977
Alignment:
| Q |
67 |
gaatttgattggatggtaattgttcactctgac |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
51541009 |
gaatttgattggatggtaattgttcactctgac |
51540977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University