View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2247_low_9 (Length: 388)
Name: NF2247_low_9
Description: NF2247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2247_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 18 - 382
Target Start/End: Original strand, 44658870 - 44659236
Alignment:
| Q |
18 |
tttttattgtttgatttcacaaccatattcgtcattaaagttttggacaacttatcaaagggaaa--agtacacattttttagacaaatgatgaagcttt |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44658870 |
tttttattgttcgatttcacaaccatattcgtcattaaagttttggacaacttatcaaagggaaatcagtacacattttttagacaaatgatgaagcttt |
44658969 |
T |
 |
| Q |
116 |
atagtatatttatgatgactgtcatcaccgtcctaacgcctctttccagctctcctattcttgtgcttggaattcttttggtcgatcgagaatcaacaga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44658970 |
atagtatatttatgatgactgtcatcaccgtcctaacgcctctttccagctctcctattcttgtgcttggaattcttttggtcgatcgagaatcaacaga |
44659069 |
T |
 |
| Q |
216 |
ctgtatacaagaaaagataaacgtgcttttccgatgaattacacgtcgttgatcagagacaagggtacttgtgctgaaaaagtttaaattaccaaccatt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44659070 |
ctgtatacaagaaaagataaacgtgcttttccgatgaattacacgtcgtcgatcagagacaagggtacttgtgctgaaaaagtttaaattaccaaccatt |
44659169 |
T |
 |
| Q |
316 |
ttttaataaatgcgaacgatcttggtcggttcannnnnnncgaaggatcatggtcggttcatctcac |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
44659170 |
ttttaataaatgcgaacgatcttggtcggttcatttttttcgaaggatcatggtcggttcatatcac |
44659236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University