View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2249_high_10 (Length: 247)
Name: NF2249_high_10
Description: NF2249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2249_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 43765667 - 43765888
Alignment:
| Q |
1 |
ctgaacaccgacaaaaaagattgtaaaccgaacgatatatgcattgtccatataactttatttgattaataatatatttcatattttttagctagtagtt |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43765667 |
ctgaacaccaacaaaaaagattgtaaaccgaacaatata--cattgtccatataactatatttgattaata---tatttcatattttttagctagtagtt |
43765761 |
T |
|
| Q |
101 |
tatcatgtctattaannnnnnnaacaataaaaattaaattatatagattgaaaaatgacactctaaattgacacatgtgtaggtagagaggctgagagca |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43765762 |
tatcatgtctattaatttttttaacaataaaaattaaattata--gattgaaaaatgacactctaaattgacacatgtgtaggtagagaggctgagagca |
43765859 |
T |
|
| Q |
201 |
gctttagggaaatatgcatcagggacaat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43765860 |
gctttagggaaatatgcatcagggacaat |
43765888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University