View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2249_low_15 (Length: 218)
Name: NF2249_low_15
Description: NF2249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2249_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 51440553 - 51440351
Alignment:
| Q |
1 |
tttgtcaattggaaggtcaatttcacttttagggaagtgannnnnnnctaccaagagtaacgagcttctgaaacttgttactagtgtatgaacaatacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51440553 |
tttgtcaattggaaggtcaatttcacttttagggaagtgatttttttctaccaagagtaacgagcttctgaaacttgttactagtgtatgaacaatacat |
51440454 |
T |
 |
| Q |
101 |
gttgaggaaaagagaatgtgatttcaagctttcaacagaagaaattaacatcttttactccacatgaccagatttgtatccacataagttggagaatgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51440453 |
gttgaggaaaagagaatgtgatttcaagctttcaacagaagaaattaacatcttttactccacatgaccagatttgtatccacataagttggagaatgat |
51440354 |
T |
 |
| Q |
201 |
ctt |
203 |
Q |
| |
|
||| |
|
|
| T |
51440353 |
ctt |
51440351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University