View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2249_low_15 (Length: 218)

Name: NF2249_low_15
Description: NF2249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2249_low_15
NF2249_low_15
[»] chr4 (1 HSPs)
chr4 (1-203)||(51440351-51440553)


Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 51440553 - 51440351
Alignment:
1 tttgtcaattggaaggtcaatttcacttttagggaagtgannnnnnnctaccaagagtaacgagcttctgaaacttgttactagtgtatgaacaatacat 100  Q
    ||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||    
51440553 tttgtcaattggaaggtcaatttcacttttagggaagtgatttttttctaccaagagtaacgagcttctgaaacttgttactagtgtatgaacaatacat 51440454  T
101 gttgaggaaaagagaatgtgatttcaagctttcaacagaagaaattaacatcttttactccacatgaccagatttgtatccacataagttggagaatgat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51440453 gttgaggaaaagagaatgtgatttcaagctttcaacagaagaaattaacatcttttactccacatgaccagatttgtatccacataagttggagaatgat 51440354  T
201 ctt 203  Q
    |||    
51440353 ctt 51440351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University