View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2251_high_11 (Length: 246)

Name: NF2251_high_11
Description: NF2251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2251_high_11
NF2251_high_11
[»] chr2 (1 HSPs)
chr2 (1-239)||(21663190-21663429)


Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 21663429 - 21663190
Alignment:
1 atggttgatgcctttcttctgtttgctttggttcccttatgaa-aatattagacagcttgggtacatgccacaccctctttttgtaaagatgttgaaact 99  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
21663429 atggttgatgcctttcttctgtttgctttggttcccttatgaacaatattagacagcttggatacatgccacaccctctttttgtaaagatgttgaaact 21663330  T
100 gcggtacaaacagtgtagcacctttgcaaccgagaatacttttgtgattttaggttattgaagcgggagttttggcagccgtgtttcattcgattcaccc 199  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
21663329 gtggtacaaacagtgtagcacctttgcaaccgagaatacttttgtgattttaggttattgcagcgggagttttggcagccgtgtttcattcgattcaccc 21663230  T
200 ctggctcaggctgtttcttccctttttagcattgtctctg 239  Q
    ||||||||||||||||||||||||||||||||||||||||    
21663229 ctggctcaggctgtttcttccctttttagcattgtctctg 21663190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University