View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2251_high_13 (Length: 234)
Name: NF2251_high_13
Description: NF2251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2251_high_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 65 - 234
Target Start/End: Complemental strand, 11180707 - 11180538
Alignment:
| Q |
65 |
gtcaagaagtctagtggttagaattcacctttttatattatttaccaacaatgaattgattcaagtaataataaaatttgacatttaagggggttcaaac |
164 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11180707 |
gtcaaaaaatctagtggttagaattcacctttttatattatttaccaacaatgaattgattcaagtaataataaaatttgacatttaaggggattcaaac |
11180608 |
T |
|
| Q |
165 |
gtcaactcttttgtatgaaaaaacttgattgataagataaaatctacctagtatatgtctcgtcggttct |
234 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
11180607 |
atcagctcttttgtatgaaaaaacttgattgataagataaaatctaccttatatatgcctcgtcggttct |
11180538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 98
Target Start/End: Original strand, 220338 - 220371
Alignment:
| Q |
65 |
gtcaagaagtctagtggttagaattcaccttttt |
98 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
220338 |
gtcaagtagtctagtggttagaattcaccttttt |
220371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 98
Target Start/End: Original strand, 689493 - 689526
Alignment:
| Q |
65 |
gtcaagaagtctagtggttagaattcaccttttt |
98 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
689493 |
gtcaagtagtctagtggttagaattcaccttttt |
689526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 98
Target Start/End: Original strand, 733961 - 733994
Alignment:
| Q |
65 |
gtcaagaagtctagtggttagaattcaccttttt |
98 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
733961 |
gtcaagtagtctagtggttagaattcaccttttt |
733994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 98
Target Start/End: Original strand, 857857 - 857890
Alignment:
| Q |
65 |
gtcaagaagtctagtggttagaattcaccttttt |
98 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
857857 |
gtcaagtagtctagtggttagaattcaccttttt |
857890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 98
Target Start/End: Complemental strand, 9031886 - 9031853
Alignment:
| Q |
65 |
gtcaagaagtctagtggttagaattcaccttttt |
98 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
9031886 |
gtcaagtagtctagtggttagaattcaccttttt |
9031853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 97
Target Start/End: Original strand, 27726345 - 27726377
Alignment:
| Q |
65 |
gtcaagaagtctagtggttagaattcacctttt |
97 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
27726345 |
gtcaagtagtctagtggttagaattcacctttt |
27726377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University