View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2251_high_5 (Length: 306)
Name: NF2251_high_5
Description: NF2251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2251_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 2926269 - 2926524
Alignment:
| Q |
1 |
gcaaaatagttacgaggcgaaaccacctgtacttcatactttggactgtccagattcttcataaaacttgttgccgcccatcctgttcccaacaccacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2926269 |
gcaaaatagttacgaggcgaaaccacctgtacttcatactttggactgtccagattcttcataaaacttgttgccgcccatcctgttcccagcaccacca |
2926368 |
T |
 |
| Q |
101 |
cttttttcctatcggtaaccgcctccacttccgatggataaaactcgcgatatgccacataaccaacaccactgcatcaaccacacacgcacacaaaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2926369 |
cttttttcctatcggtaaccgcctccacttccgatggataaaactcgcgatatgccacataaccaacaccactgcatcaaccaca----cacacaaaaca |
2926464 |
T |
 |
| Q |
201 |
catcaaatattt-tataatcacatatatatcgcaagactatgcagcatagacacagacac |
259 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2926465 |
catcaaatatttgtataatcacatatatatcgcaagactatgcatcatagacacagacac |
2926524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University