View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2251_high_9 (Length: 249)
Name: NF2251_high_9
Description: NF2251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2251_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 21787900 - 21787664
Alignment:
| Q |
1 |
ctgaatttgagtttatatattattcaatatggtccttttagaatcaaaattaaactttgaggttgaggttttaatttgatattgatggtagcattgatga |
100 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
21787900 |
ctgaatttgagtttatatattca--aatacggtccttttagaatcaaaattaaactttgaggttgagtttttaatttgatattgatggcagcattgatga |
21787803 |
T |
|
| Q |
101 |
cctttgtatcgtctatgcatacactataaccttatattagggtatttggttatgttggattttggtatctaggttagactttagaggagtgtggtttgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21787802 |
cctttgtatcgtctatgcatacactataaccttatattagggtatttggttatgttggattttggaatctaggttagactttagaggagtgtggtttgtt |
21787703 |
T |
|
| Q |
201 |
atacagattttcttcatgctatttaaatatggtcctttg |
239 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21787702 |
atacagattttcttcatgctattcaaatatggtcctttg |
21787664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University