View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2251_low_11 (Length: 271)
Name: NF2251_low_11
Description: NF2251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2251_low_11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 7 - 271
Target Start/End: Complemental strand, 36276386 - 36276122
Alignment:
| Q |
7 |
atatcactactcactagtgttagcaacggcttggcaaacgattttggagtaccttgatgtgttctattcaagttaacatcgctatgagagtaatcaacaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36276386 |
atatcactactcactagtgttagcaacggcttggcaaacgattttggagtaccttgatgtgttctattcaagttaacatcgctatgagagtaatcaacaa |
36276287 |
T |
|
| Q |
107 |
tgttgtgtacaggtgaaaagcgatggcaaccataataaagggatcttttgggagggaggaagaaggagggccgtaaagaatcatcaaaggaagctaagta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36276286 |
tgttgtgtacaggtgaaaagcgatggcaaccataataaagggatcttttgggagggaggaagaaggagggccgtaaagaatcatcaaaggaagctaagta |
36276187 |
T |
|
| Q |
207 |
gagaacatgttgcacatagcatcaatattcaatgacaattatttgtctcgtgtttcttttatatt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36276186 |
gagaacatgttgcacatagcatcaatattcaatgacaattatttgtctcgtgtttcttttatatt |
36276122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University