View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2251_low_15 (Length: 246)
Name: NF2251_low_15
Description: NF2251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2251_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 21663429 - 21663190
Alignment:
| Q |
1 |
atggttgatgcctttcttctgtttgctttggttcccttatgaa-aatattagacagcttgggtacatgccacaccctctttttgtaaagatgttgaaact |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21663429 |
atggttgatgcctttcttctgtttgctttggttcccttatgaacaatattagacagcttggatacatgccacaccctctttttgtaaagatgttgaaact |
21663330 |
T |
 |
| Q |
100 |
gcggtacaaacagtgtagcacctttgcaaccgagaatacttttgtgattttaggttattgaagcgggagttttggcagccgtgtttcattcgattcaccc |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21663329 |
gtggtacaaacagtgtagcacctttgcaaccgagaatacttttgtgattttaggttattgcagcgggagttttggcagccgtgtttcattcgattcaccc |
21663230 |
T |
 |
| Q |
200 |
ctggctcaggctgtttcttccctttttagcattgtctctg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21663229 |
ctggctcaggctgtttcttccctttttagcattgtctctg |
21663190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University