View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2251_low_16 (Length: 238)
Name: NF2251_low_16
Description: NF2251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2251_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 21663492 - 21663712
Alignment:
| Q |
1 |
agcaaacgaaatggtgcaagtggaaggggcggttgcaactaatagcaatagaagggtgatatggttctctaacttactagggacatgctcaacctaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21663492 |
agcaaacgaaatggtgcaagtggaaggggcggttgcaactaacagcaatagaagggtgatatggttctctaacttactagggacatgctcaatctaatat |
21663591 |
T |
|
| Q |
101 |
gcgaagtgggaactcagcttcatggggaaaaaatagggtcttcacgggatatagaaaggggggccatgaaaccaaaagggtaacaagaaaattgcaaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21663592 |
gcgaagtgggaactcagcttcatggggaaaaaatagggtcttcacgggatatagaaaggggggccatgaaaccaaaagggtaacaagaaaattgcaaaag |
21663691 |
T |
|
| Q |
201 |
gaacattgggcttggctgatt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
21663692 |
gaacattgggcttggctgatt |
21663712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University