View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2251_low_9 (Length: 293)
Name: NF2251_low_9
Description: NF2251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2251_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 20 - 285
Target Start/End: Complemental strand, 54881066 - 54880801
Alignment:
| Q |
20 |
gtggttgcattagtgacatctgactcatgagattctttaaaatattaaaagatccagatgcgacggtgtattcatacttgacagatatcacaaagagggt |
119 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54881066 |
gtggttgaattagtcacatctgactcatgagattctttaaaatattaaaagatccagatgcgacggtgtattcatacttgacagatatcacaaagagggt |
54880967 |
T |
|
| Q |
120 |
agtctttggagttgaggtgaacaagagaaaaacgagtgtgtttggttgcgagcttgttggcacggtggatggtatgatcacatccatggcaaagagcagc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54880966 |
agtctttggagttgaggtgaacaagagaaaaacgagtgtgtttggttgcgagcttgttggcacggtggatggtatgatcacatccatggcaaagagcagc |
54880867 |
T |
|
| Q |
220 |
ttcatctgaaggacagaacatagtagcctcagctttctcacacacatcacattggatcttcatctc |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54880866 |
ttcatctgaaggacagaacatagtagcctcagctttctcacacacatcacattggatcttcatctc |
54880801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University