View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2252_high_27 (Length: 216)
Name: NF2252_high_27
Description: NF2252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2252_high_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 54470085 - 54470273
Alignment:
| Q |
16 |
caatatagtgacttagtggattgacacggaagatgaatatattacatgttagaaaaacaaaattgatggaggttatatttaagaaccaaagtgcttcagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
54470085 |
caatatagtgacttagtggattgacacggaagatgaatatattacatgttagaaaaacaaaattgatggaggttatatttaagaactaaagtgcttcagt |
54470184 |
T |
|
| Q |
116 |
tatggagtcctccctcgaggggcttcttaaaaatcaacgtagattctcatcttctagatgatggcatgttggggtttaggattcatctc |
204 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54470185 |
tgtggagtcctccctcgaggggcttcttaaaaatcaacgtagattctcatcttctagatgatggcatgttggggtttaggattcatctc |
54470273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University