View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2252_high_3 (Length: 531)

Name: NF2252_high_3
Description: NF2252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2252_high_3
NF2252_high_3
[»] chr7 (3 HSPs)
chr7 (357-462)||(38428687-38428793)
chr7 (460-524)||(25487135-25487199)
chr7 (460-524)||(25433565-25433629)


Alignment Details
Target: chr7 (Bit Score: 75; Significance: 3e-34; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 357 - 462
Target Start/End: Complemental strand, 38428793 - 38428687
Alignment:
357 aacaccccaatttttgtattgatatattttagtattattatg-taaaatattaccccaagtatgtttgttgtggattgacaatttttaatgtgtttttct 455  Q
    |||||||||||||||||||||||||| ||||| ||||||||| |||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||    
38428793 aacaccccaatttttgtattgatatactttaggattattatgctaaattattaccccaaatatgtttgatgtggattgacaatttttaatgtgtttttct 38428694  T
456 atatgtg 462  Q
     ||||||    
38428693 ttatgtg 38428687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 460 - 524
Target Start/End: Original strand, 25487135 - 25487199
Alignment:
460 gtgctcatattatataatacaaaattttcaggaaaacccacatctctttctgattgcctatgcta 524  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||||||| |||||||||    
25487135 gtgctcatattatataaatcaaaattttcaggaaaacccacatctctttctgattccctatgcta 25487199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 460 - 524
Target Start/End: Complemental strand, 25433629 - 25433565
Alignment:
460 gtgctcatattatataatacaaaattttcaggaaaacccacatctctttctgattgcctatgcta 524  Q
    ||||||||||||||| ||||||| |||||||||||||| | || ||||||||||| |||| ||||    
25433629 gtgctcatattatatcatacaaatttttcaggaaaaccaatatgtctttctgattccctacgcta 25433565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University