View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2252_high_4 (Length: 492)
Name: NF2252_high_4
Description: NF2252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2252_high_4 |
 |  |
|
| [»] scaffold0022 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0022 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 367
Target Start/End: Complemental strand, 84114 - 83794
Alignment:
| Q |
17 |
aagctttacaggctttgttctgcaaatgtaatgcagagagtatctcaatctcttgaggttgaggaggagagtttggtttagggtttggtgtgggccagcc |
116 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
84114 |
aagctttgcaggctttgttctgcaaatgtaatgcagagagtctctcaatctcttgaggttgaggaggag------------ggtttggtgtgggccagcc |
84027 |
T |
 |
| Q |
117 |
tgtttgaggagagtttcttgaaacggggaccgggaccggccaacccggtgaatcgggttttgtatcgttgttatcatcagtgttaaccctctggttctca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |||||||| |
|
|
| T |
84026 |
tgtttgaggagagtttcttgaaacggggacggggaccggccaacccggtgaatcgggttttgtaacgttgttatcatctgtgttaaccctccggttctca |
83927 |
T |
 |
| Q |
217 |
gaggaaatgggtccgggttttgtaactttctttttctcgttgttatttcttttcttgaaagtggtggaattcacaggagggagggatctggtgtggggag |
316 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
83926 |
gaggaaatgggttcgggttttgtaactttcttt------------------ttcttgaatgtggtggaattcacaggagggagggatctggtgtggggag |
83845 |
T |
 |
| Q |
317 |
gtagaaaaggatcatgatgatgacgccaatgaggaagaatagggtttgatt |
367 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
83844 |
gtggaaaaggatcatgatgatgacgccaatgaggaagaatagggtttgatt |
83794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022; HSP #2
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 399 - 483
Target Start/End: Complemental strand, 83756 - 83672
Alignment:
| Q |
399 |
ggggccttgttgccaaagataatgaagatagattacttcatctcttagcttctgttcgtcgtaagaattcttcatttttcctatg |
483 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
83756 |
ggggccttgttgccaaagataatgaagatagattacttcatctcttagcttctgttcgtcgtaagaattcttcatttttcctatg |
83672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University