View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2252_low_15 (Length: 352)
Name: NF2252_low_15
Description: NF2252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2252_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 3e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 11 - 186
Target Start/End: Original strand, 40439023 - 40439198
Alignment:
| Q |
11 |
agaatatgaatgtttaatgagtttaaattaaaatgggggattagggtcataaagaacattgaatgcagtgaagaagaagaacgaagagagcatggaaaga |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40439023 |
agaaaatgaatgtttaatgagtttaaattaaaattagggattagggtcacaaagaacattgaatgcagtgaagaagaagaacgaagagagcatggaaaga |
40439122 |
T |
|
| Q |
111 |
aaccattttttctcnnnnnnntttcccaagacaattttctctcaatatttcggtaaagaatattgaaatagagaac |
186 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40439123 |
aaccattttttctcaaaaaaatttcccacgacaattttctctcaatatttcggtaaagaatattgaaatagagaac |
40439198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 254 - 336
Target Start/End: Original strand, 40439266 - 40439348
Alignment:
| Q |
254 |
agggctgggtttcacaggttgttcatgatggagggttgggtttcacggtttgttcatggaggtgaagaatctcagcttcatgt |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40439266 |
agggctgggtttcacaggttgttcatgatggagggttgggtttcacggtttgttcatggtggtgaagaatctcagcttcatgt |
40439348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University