View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2252_low_23 (Length: 248)
Name: NF2252_low_23
Description: NF2252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2252_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 3 - 234
Target Start/End: Complemental strand, 33576026 - 33575808
Alignment:
| Q |
3 |
ataagaacataattaaaacaaagattgagtttagcttatccgtctcatcccaatttaattcgaggacaaagnnnnnnnaaatattattttaaatactctc |
102 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
33576026 |
ataagaacataattaaaacaaaaattgagtttaggttacccgtctcatcccaatttaattcgaagacaaagtttttttaaatattattttaaatactctc |
33575927 |
T |
 |
| Q |
103 |
tcagactcatgatacacgactctttctcatccacattattcactttctatttcgaatatctatttcgaatatcaacctaatgtgatgaatgagtcttgtc |
202 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
33575926 |
taagactcatgatacatgactctttctcatccacattattcactttctatttcgaa-------------tatcaacctagtgtgatgaatgagtcttgtc |
33575840 |
T |
 |
| Q |
203 |
ttacattaaggaatgaccatgcctgttccaag |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33575839 |
ttacattaaggaatgaccatgcctgttccaag |
33575808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University