View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2252_low_27 (Length: 233)
Name: NF2252_low_27
Description: NF2252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2252_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 221
Target Start/End: Complemental strand, 12393895 - 12393687
Alignment:
| Q |
13 |
caaaggcataattccacgtgacccagcacgattttcgttgttttgattatttgcttcagagtaatcatagtgtggggttgcagtagcagcaagattttgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12393895 |
caaaggcataattccacgtgacccagcacgattttcgttgttttgattatttgcttcagagtaatcatagtgtggggttgcagtagcagcaagattttgt |
12393796 |
T |
 |
| Q |
113 |
tcctgactagataatttacaagaagaaaaaataaactcaacctcttatgtctagtaagattccaacttctaataatggccattaacaaaaattgagagga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12393795 |
tcctgactagataatttacaagaagaaaaaataaactcaacctcttatgtctagtaagattccaacttctagtaatggccattaacaaaaattgagagga |
12393696 |
T |
 |
| Q |
213 |
tgtgaaagg |
221 |
Q |
| |
|
| ||||||| |
|
|
| T |
12393695 |
tatgaaagg |
12393687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University