View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2253_high_13 (Length: 311)
Name: NF2253_high_13
Description: NF2253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2253_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 9 - 295
Target Start/End: Complemental strand, 25496493 - 25496207
Alignment:
| Q |
9 |
agcacagagatgcagcacagatggcagcaactgaggccatgcaagaggctgctgctgctgacagtttgctacaatgtcttaggtattgactttagatcag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25496493 |
agcacagagatgcagcacagatggcagcaactgaggccatgcaagaggctgctgctgctgacagtttgctacaatgtcttaggtattgactttagatcag |
25496394 |
T |
|
| Q |
109 |
attttcagatctttgtttcttaatccggttgagattttggactgatcatgtcaagaaatttcaatttcaatttgaaaccaagatatgcattattaataaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25496393 |
attttcagatctttgtttcttaatccggttgacattttggactgatcatgtcaagaaatttcaatttcaatttgaaaccaagatatgcattattaataaa |
25496294 |
T |
|
| Q |
209 |
ggtttttcagtaatttcgttatcaagttgaaacaaatcaccttttgaggatatgcaaaaaataatatgatatatactgataccaaag |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25496293 |
ggtttttcagtaatttcgttatcaagttgaaacaaatcaccttttgaggatatgcaaaaaataatatgatatatactgataccaaag |
25496207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University