View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2253_high_21 (Length: 250)
Name: NF2253_high_21
Description: NF2253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2253_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 11 - 235
Target Start/End: Original strand, 5371705 - 5371929
Alignment:
| Q |
11 |
cataggagcgtgctaggatcaatcccaaccgtcaaaataatctctagcggtttccaggattcacgccgcaaaaccgagatgtagttattgacctcttcga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5371705 |
cataggagcgtgctaggatcaatcccaaccgtcaaaataatctctagcggcttccaggattcacgccgcaaaaccgagatgtagttattgacctcttcga |
5371804 |
T |
|
| Q |
111 |
ctgtttaagtgtgactcagcgccacacaagatatattctcattcacccaattctcacacacaatccacctctttcaaatactaactcgggcattgaagtg |
210 |
Q |
| |
|
|| | |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5371805 |
ctatataagtgtgactcagcggcacgcaagatatattctcattcacccaattctcacacacaatccacctctttcaaatactgactcgggcattgaagtg |
5371904 |
T |
|
| Q |
211 |
ctaacgtgtctgcagacacaattct |
235 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5371905 |
ttaacgtgtctgcagacacaattct |
5371929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 235
Target Start/End: Original strand, 30808627 - 30808711
Alignment:
| Q |
151 |
attcacccaattctcacacacaatccacctctttcaaatactaactcgggcattgaagtgctaacgtgtctgcagacacaattct |
235 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||| |||| ||| | | ||| ||||||||||||||||||| ||| ||||| |
|
|
| T |
30808627 |
attcacccagttttcacacacaatccacctctttcacataccgacttgagtgttggagtgctaacgtgtctgcaggcaccattct |
30808711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University