View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2253_high_31 (Length: 203)
Name: NF2253_high_31
Description: NF2253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2253_high_31 |
 | |
|
| [»] scaffold0728 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0728 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: scaffold0728
Description:
Target: scaffold0728; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 4656 - 4484
Alignment:
| Q |
19 |
ggatgcacatatggacactcagtccaatcatgagattgtgaacgggaacaacgaaggaccttgaaagaaaacatccgaaattcatcgcttgcatacatgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4656 |
ggatgcacatatggacactcagtccaatcatgagattgtgaacgggaacaacgaaggaccttgaaagaaaacatccgaaattcatcgcttgcatacatgc |
4557 |
T |
|
| Q |
119 |
tgttttttataccaggaaatgatggatcaactggatactgtttattcacggtaaatttcgaatccaccacagg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4556 |
tgttttttataccaggaaatgatggatcaactggatactgtttattctcggtaaatttcgaatccaccacagg |
4484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 19409090 - 19408918
Alignment:
| Q |
19 |
ggatgcacatatggacactcagtccaatcatgagattgtgaacgggaacaacgaaggaccttgaaagaaaacatccgaaattcatcgcttgcatacatgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19409090 |
ggatgcacatatggacactcagtccaatcatgagattgtgaacgggaacaacgaaggaccttgaaagaaaacatccgaaattcatcgcttgcatacatgc |
19408991 |
T |
|
| Q |
119 |
tgttttttataccaggaaatgatggatcaactggatactgtttattcacggtaaatttcgaatccaccacagg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19408990 |
tgttttttataccaggaaatgatggatcaactggatactgtttattctcggtaaatttcgaatccaccacagg |
19408918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 17 - 157
Target Start/End: Original strand, 9314791 - 9314931
Alignment:
| Q |
17 |
caggatgcacatatggacactcagtccaatcatgagattgtgaacgggaacaacgaaggaccttgaaagaaaacatccgaaattcatcgcttgcatacat |
116 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| | || ||| |||||| || | |||||||| ||| |||| || |||||||| | |||||||| |
|
|
| T |
9314791 |
caggatgcacaaaaggacactcagtccaatcatgagagtatgcacgagaacaaggacgaaccttgaatgaatacatgcggaattcatctgtggcatacat |
9314890 |
T |
|
| Q |
117 |
gctgttttttataccaggaaatgatggatcaactggatact |
157 |
Q |
| |
|
|||||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
9314891 |
gctgttttttatgtcaggaagagatgggtcaactggatact |
9314931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 66 - 155
Target Start/End: Original strand, 11688458 - 11688547
Alignment:
| Q |
66 |
acaacgaaggaccttgaaagaaaacatccgaaattcatcgcttgcatacatgctgttttttataccaggaaatgatggatcaactggata |
155 |
Q |
| |
|
|||| |||||||||||| ||| |||| ||||||||||| | ||||| ||||||||| ||||| |||||| ||||||||||| |||||| |
|
|
| T |
11688458 |
acaaagaaggaccttgaccgaatacatgcgaaattcatctgtggcatatatgctgtttcttatatcaggaattgatggatcaattggata |
11688547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 76 - 155
Target Start/End: Complemental strand, 36456241 - 36456162
Alignment:
| Q |
76 |
accttgaaagaaaacatccgaaattcatcgcttgcatacatgctgttttttataccaggaaatgatggatcaactggata |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||| ||| || ||||||||||| ||| |||||| ||||||||||| ||||| |
|
|
| T |
36456241 |
accttgaaagaatacattcgaaattcatcagttgagtatatgctgtttttgatatcaggaagggatggatcaacaggata |
36456162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University