View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2253_low_17 (Length: 307)
Name: NF2253_low_17
Description: NF2253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2253_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 19 - 300
Target Start/End: Complemental strand, 28733889 - 28733608
Alignment:
| Q |
19 |
aattcagcctctaattccaaatttgacgcctgtgcagtatctaactcctcagttacacgtgttatcattcggttactttcatcagcttcttctgttatgt |
118 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28733889 |
aattcagcctctaactccaaatttgacgcctgtgcagtatctaactcctcagttacacgtgttatcattcggttactttcatcagcttcttctgttatgt |
28733790 |
T |
 |
| Q |
119 |
agctgagttttgtcaaagcctctcgctccgcggcccttgctgcctcagcggaagcaacagcctcatccatgattttattcttctctaactcctctctctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28733789 |
agctgagttttgtcaaagcctctcgctccgcggcccttgctgcctcagcggaagcaacagcctcatccatgattttattcttctctaactcctctctctt |
28733690 |
T |
 |
| Q |
219 |
tatttccatcttaagtgtattgttctcttcagttatattttgtagttttgtctctctctccaataatcttgccttcatctca |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28733689 |
tatttccatcttaagtgtattgttctcttcagttatattttgtagttttgtctctctctccaataatcttgccttcaactca |
28733608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University