View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2253_low_18 (Length: 302)

Name: NF2253_low_18
Description: NF2253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2253_low_18
NF2253_low_18
[»] chr7 (2 HSPs)
chr7 (10-188)||(42221192-42221370)
chr7 (260-293)||(42220886-42220919)


Alignment Details
Target: chr7 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 10 - 188
Target Start/End: Complemental strand, 42221370 - 42221192
Alignment:
10 aagaaaatacaaacaatttctcatatcaatgataatccatttcagactttgcaattagatgaatagatgataattgagaaagattaggggggatctctga 109  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||| ||||||||||||||||||||||||||    
42221370 aagaaaatacaaacaatttctcatatcaatgataatccatttctgactttgcaattagatgaataaataataaatgagaaagattaggggggatctctga 42221271  T
110 cagaattcttagccacttaaaaattgaataatgttgagtgggacccattattcaagtagaaaaagaagaaaaaaggaat 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42221270 cagaattcttagccacttaaaaattgaataatgttgagtgggacccattattcaagtagaaaaagaagaaaaaaggaat 42221192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Complemental strand, 42220919 - 42220886
Alignment:
260 attgcacatgtatgagaaaaatatcccgcagtat 293  Q
    ||||||||||||||||||||||||||||| ||||    
42220919 attgcacatgtatgagaaaaatatcccgctgtat 42220886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University