View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2253_low_28 (Length: 241)
Name: NF2253_low_28
Description: NF2253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2253_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 11025608 - 11025830
Alignment:
| Q |
1 |
cctgccctcgatgggtcttctaattttttgcacatcgaccaaacacgagcttggggggtgcgaacaccaataggttttttggttgcaatagcaataccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11025608 |
cctgccctcgatgggtcttctaattttttgcacatcgaccaaacacgagcttggggggtgcgaacacgaataggttttttggttgcaatagcaataccaa |
11025707 |
T |
|
| Q |
101 |
tagcatttgtggtggattcaaacaacatagatattgtcacaatgaggagaacaacgaggtaggttttggtgagagccannnnnnncactcttttttctcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
11025708 |
tagcatttgtggtggattcaaacaacatagatattgtcacaatgaggagaacaacgaggtaggttttggtgagagtcatttttttcactcttttttctcc |
11025807 |
T |
|
| Q |
201 |
tcaacgggagaagaggagattag |
223 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
11025808 |
tcaatgggagaagaggagattag |
11025830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 99 - 222
Target Start/End: Complemental strand, 10891350 - 10891225
Alignment:
| Q |
99 |
aatagcatttgtggtggattcaaacaacatagatattgtcacaatgaggagaacaacgaggtaggttttggtgagagcca--nnnnnnncactctttttt |
196 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||| | |||||| |||| ||||| |||||||| || |
|
|
| T |
10891350 |
aatagcatttgtggtgggtgcaaacaacatagatattatcacaatgaggagaacaacgagatgggttttagtgaaagccattttaatctcactctttgtt |
10891251 |
T |
|
| Q |
197 |
ctcctcaacgggagaagaggagatta |
222 |
Q |
| |
|
||||||||| ||||||||||||||| |
|
|
| T |
10891250 |
ctcctcaacaagagaagaggagatta |
10891225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University