View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2253_low_8 (Length: 386)
Name: NF2253_low_8
Description: NF2253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2253_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 53 - 370
Target Start/End: Original strand, 32874285 - 32874604
Alignment:
| Q |
53 |
gacatgggttcaaacacgcaactcttcaatcatcaacactttgtatgtttgagtttcgccgttatactttgttggcaaaaattgcacatctcttcctgac |
152 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32874285 |
gacaagggttcaaacacgcaactcttcaatcatcaacactttgtatgtttgagtttcgttgttatactttgttggcaaaaattgcacatctcttcatgac |
32874384 |
T |
|
| Q |
153 |
aagcaagtcttgaattgtcacaagatcaaatatatagtgtttatgacgagcaaatcttgaatcgtcacaagaccaaatatatagtgtttatgcaaacac- |
251 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874385 |
gagcaagtcttgaattgtcacaagaccaaatatataatgtttatgtcgagcaaatcttgattcgtcacaagaccaaatatatagtgtttatgcaaacaca |
32874484 |
T |
|
| Q |
252 |
-agagacacatatctctaaaatgtaacatctttatttgttataattattcggaaagtttctcttttgtgtgtgcccaaacactatatatttgatgttcta |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
32874485 |
aagagacacatatctctaaaatgtaacatctttatttgttataattatttggaaagtttctcttttgtgtgtgcctaaacactataaatttgatgttcta |
32874584 |
T |
|
| Q |
351 |
accatacaagaattgctcct |
370 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
32874585 |
accatacaagaattgctcct |
32874604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University