View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2254_low_9 (Length: 225)
Name: NF2254_low_9
Description: NF2254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2254_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 26428696 - 26428530
Alignment:
| Q |
1 |
tttgttgtcaatttagttgttgcgaaataata----ttttattttatgatgtgattgttttttgtatgttggattagagtgctctttgtattctgcaaat |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
26428696 |
tttgttgtcaatttagttgttgcgaaatactaatatttttattttgtgatgcgattgttttttgtatgttggattagagtgctctttgtatt-tgtaaat |
26428598 |
T |
 |
| Q |
97 |
aaaggttatttggttatcgatttctttttctcaataatgaatctcatgcttacaaatcccaaccaaata |
165 |
Q |
| |
|
|| ||||||| |||||||||||||||||| ||| ||||||||| ||| |||||||| |||||||||| |
|
|
| T |
26428597 |
aatatttatttgattatcgatttctttttcttaatgatgaatctc-tgcgtacaaatctcaaccaaata |
26428530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 150 - 210
Target Start/End: Complemental strand, 26428452 - 26428392
Alignment:
| Q |
150 |
aaatcccaaccaaataatcacgttgattcttcctaattaaattaagggtttgtcatagcac |
210 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26428452 |
aaatcccaaccaaatgatcacgttgattcttcctaattaaattaagggtttgtcatggcac |
26428392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University