View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2256_high_2 (Length: 307)
Name: NF2256_high_2
Description: NF2256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2256_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 79 - 289
Target Start/End: Complemental strand, 34678559 - 34678349
Alignment:
| Q |
79 |
aatgcaggttaacaactaatgtgcacttcttcacataaaaaatacttccaacctcatatcgatgacaatactgcatataggatgggtgcaaatagaaata |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34678559 |
aatgcaggttaacaactaatgtgcacttcttcacataagaaatacttccaacctcatatcgatgacaatattgcatataggatgggtgcaaatagaaata |
34678460 |
T |
|
| Q |
179 |
aggtttgtaatgaaattaattagattcatctagaagtttataaattagacttctatttatgcttataaaatacttcaaggaatttagtaaatgctcattt |
278 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34678459 |
aggtttgtaatgaaattaataagattcatctagaagtttataaattagacttctatttatgcttataaaatacttcaaggaatttagtaaatgctcattt |
34678360 |
T |
|
| Q |
279 |
gtgaaagaaat |
289 |
Q |
| |
|
||||||||||| |
|
|
| T |
34678359 |
gtgaaagaaat |
34678349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 15 - 50
Target Start/End: Complemental strand, 34678623 - 34678588
Alignment:
| Q |
15 |
cataggcatggcggaggaagtaattcatgacaataa |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34678623 |
cataggcatggcggaggaagtaattcatgacaataa |
34678588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University