View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2256_low_5 (Length: 254)

Name: NF2256_low_5
Description: NF2256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2256_low_5
NF2256_low_5
[»] chr7 (4 HSPs)
chr7 (1-240)||(12820013-12820252)
chr7 (101-199)||(19326123-19326221)
chr7 (99-161)||(19344751-19344813)
chr7 (126-161)||(19374626-19374661)
[»] chr6 (1 HSPs)
chr6 (101-161)||(24254602-24254662)


Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 12820252 - 12820013
Alignment:
1 tgttgttatttatcttggcattatgtttaatgaaggtgtgtatttgaatggcactgtttactggttttccaatccaaataagagttttaagtatagtgag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
12820252 tgttgttatttatcttggcattatgtttaatgaaggtgtgtatttgaatggcactgtttactggttttccaatccgaataagagttttaagtatagtgag 12820153  T
101 aaggattttactgttgaacaacttatgattatctcccttgatcttagtaccgagacatacacgcgcttgttgccccctcgtgaggttgatgaagtgccag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||    
12820152 aaggattttactgttgaacaacttatgattatctcccttgatcttagtaccgagatatacacgcgcttgctgccccctcgtgaggttgatgaagtgccag 12820053  T
201 ttgttcaacaaagtcttgctgtattaagggaccgcctttg 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
12820052 ttgttcaacaaagtcttgctgtattaagggaccgcctttg 12820013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 101 - 199
Target Start/End: Complemental strand, 19326221 - 19326123
Alignment:
101 aaggattttactgttgaacaacttatgattatctcccttgatcttagtaccgagacatacacgcgcttgttgccccctcgtgaggttgatgaagtgcca 199  Q
    |||||| |||| || || ||| ||||||||||||||||||||||| |||| |||||||||| ||  ||   | |||||||||  |||||||||||||||    
19326221 aaggatattaccgtcgagcaatttatgattatctcccttgatcttggtactgagacatacaagcaatttcagacccctcgtggtgttgatgaagtgcca 19326123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 99 - 161
Target Start/End: Complemental strand, 19344813 - 19344751
Alignment:
99 agaaggattttactgttgaacaacttatgattatctcccttgatcttagtaccgagacataca 161  Q
    |||||||| |||||||||   || || |||||||||||||||||||| |||||||||||||||    
19344813 agaaggatattactgttgggaaatttgtgattatctcccttgatcttggtaccgagacataca 19344751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 126 - 161
Target Start/End: Original strand, 19374626 - 19374661
Alignment:
126 tgattatctcccttgatcttagtaccgagacataca 161  Q
    |||||||||||||||||||| |||||||||||||||    
19374626 tgattatctcccttgatcttggtaccgagacataca 19374661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 101 - 161
Target Start/End: Complemental strand, 24254662 - 24254602
Alignment:
101 aaggattttactgttgaacaacttatgattatctcccttgatcttagtaccgagacataca 161  Q
    |||||| |||| ||||| ||| | ||||||||||||||||||||| |||| ||||||||||    
24254662 aaggatattaccgttgagcaattcatgattatctcccttgatcttggtactgagacataca 24254602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University