View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2257_low_2 (Length: 395)

Name: NF2257_low_2
Description: NF2257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2257_low_2
NF2257_low_2
[»] chr1 (1 HSPs)
chr1 (339-387)||(9113738-9113786)


Alignment Details
Target: chr1 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 339 - 387
Target Start/End: Complemental strand, 9113786 - 9113738
Alignment:
339 aaatatttaattaatactatgtaatttctttttccacgttcttcatctc 387  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
9113786 aaatatttaattaatactatgtaatttctttttccacgttcttcatctc 9113738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University