View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_1D_high_15 (Length: 265)
Name: NF2258_1D_high_15
Description: NF2258_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_1D_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 11 - 262
Target Start/End: Original strand, 43527994 - 43528245
Alignment:
| Q |
11 |
atatatgcaaataccccaaccctacctatgataaatatgtctcaccaatcttctacacaactggagactttatctttgtgtagatcatccgactttggag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43527994 |
atatatgcaaataccccaaccctacctatgataaatatgtctcaccaatcttctacacaactggagactttatctttgtgtagatcatccgactttggag |
43528093 |
T |
 |
| Q |
111 |
gttagcccaatatatatctcaccaatgtcgttttgaatatcaatctggtgtgtttgaaaagaatcaaaattacagtgctagtatccccggtgagaaaata |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43528094 |
gttagcccaatatatatctcaccaatgtcgttttgaatatcaatctgctgtgtttgaaaagaatcaaaattacagtgctagtatccccggtgagaaaata |
43528193 |
T |
 |
| Q |
211 |
cgagactaatctcttgaggtagaaaatatgaagattagactaatcctttgag |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43528194 |
cgagactaatctcttgaggtagaaaatatgaagattagactaatcctttgag |
43528245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University