View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_1D_high_20 (Length: 224)
Name: NF2258_1D_high_20
Description: NF2258_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_1D_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 33 - 203
Target Start/End: Complemental strand, 31416538 - 31416368
Alignment:
| Q |
33 |
tgtcaacttataattaatctttttaaaactcaaaagaaacgtgtttgtctatctttcaaatcttttgttcattcggatggagccctcgtctaatacatcg |
132 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31416538 |
tgtcaacctgtaattaatctttttaaaactcaaaagaaacgtatttgtctatctttcaaatcttttgttcattcggatgtggccctcgtctaatacatcg |
31416439 |
T |
 |
| Q |
133 |
ttctgcgttggcttagcattcaatggtgtggttgatttgaaaggatcataatgatgttattttctctaata |
203 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31416438 |
ttctgcgttagcttagcattcaatggtgtggttgatttaaaaggatcataatgatgttattttctctaata |
31416368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University