View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_1D_high_22 (Length: 220)
Name: NF2258_1D_high_22
Description: NF2258_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_1D_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 27 - 129
Target Start/End: Complemental strand, 9086485 - 9086383
Alignment:
| Q |
27 |
gactgaaatgaaaaatgctaaacttacctaagccttcatttgtagaaatcaaagatgcagttttttctttaaagcagaagagtgatatcggtctttatat |
126 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9086485 |
gactaaaatgaaaaatgctaaacttacctaagccttcatttgtagaaatcaaagatgcagttttttctttaaagcagaagagtgatattggtctttatat |
9086386 |
T |
 |
| Q |
127 |
atg |
129 |
Q |
| |
|
||| |
|
|
| T |
9086385 |
atg |
9086383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University