View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_1D_low_19 (Length: 288)
Name: NF2258_1D_low_19
Description: NF2258_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_1D_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 29 - 278
Target Start/End: Complemental strand, 2755101 - 2754850
Alignment:
| Q |
29 |
gttgaattggcttaatcccggttatagtagagtctcgttgaactggtctgagtcgtagtttgtttgatctccgttctgattgattttttaaacattgaga |
128 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2755101 |
gttgaattggcttaatcctggttatagtagagtctcgttgaactggtccgagtcgtagtttgtttgatctccgttctgattgattttttaaacattgaga |
2755002 |
T |
 |
| Q |
129 |
gataatat--cttgtaattaagcactagtgtgatgagttatttacaaacctatatgaacaatagaagtcacaattatgtaattttccaatcaaaattaag |
226 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2755001 |
gataatatatcttgtaattaagcactagtgtgatgagttatttacaaacctatatgaacaatagaagtcacaattatgcaattttccaatcaaaattaag |
2754902 |
T |
 |
| Q |
227 |
atttctgttcatggtttcaggttggcacacatatttttggattgctttcatt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2754901 |
atttctgttcatggtttcaggttggcacacatatttttggattgctttcatt |
2754850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 182 - 278
Target Start/End: Complemental strand, 2747150 - 2747051
Alignment:
| Q |
182 |
gaacaatagaagtcacaattatgtaattttccaa---tcaaaattaagatttctgttcatggtttcaggttggcacacatatttttggattgctttcatt |
278 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| ||||||||||||||| |||| || |||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
2747150 |
gaacaatagaagtcacaattatgtcattgtccaacaatcaaaattaagatttatgtttattgtttcaggttggcacacatacttttgggttgctttcatt |
2747051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University