View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_1D_low_31 (Length: 261)
Name: NF2258_1D_low_31
Description: NF2258_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_1D_low_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 2 - 123
Target Start/End: Original strand, 345289 - 345410
Alignment:
| Q |
2 |
cctcccctccccctcttaaacccactcccaaactgttggggaattcggaggagcacgggagcaataacaggccaatgctccaggatggagatgccacatt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
345289 |
cctcccctccccctcttaaacccactcccaaactgttggggaattcggaggagcacgggagcaataacaggccaatgcttcaggatggagacgccacatt |
345388 |
T |
|
| Q |
102 |
cccacctaaaaccttaaggcat |
123 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
345389 |
cccacctaaaaccttaaggcat |
345410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 125 - 239
Target Start/End: Original strand, 345463 - 345577
Alignment:
| Q |
125 |
gcgatgtgagacttaaccactcacacttgtaactgtacacaaataaaagtccttagattgttaaaagggctaactcacctccaaagcaaaattacgttgt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
345463 |
gcgatgtgagacttaaccactcacacttgtaacggtacacaaataaaagtccttagattgttaaaagggctaactcacctccaaagcaaaattacgttgt |
345562 |
T |
|
| Q |
225 |
ccagaaggatcccct |
239 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
345563 |
ccagaaggatcccct |
345577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University