View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_1D_low_37 (Length: 241)
Name: NF2258_1D_low_37
Description: NF2258_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_1D_low_37 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 44427406 - 44427648
Alignment:
| Q |
1 |
tcagtaacaacctcttcatttgacgcaccctcggaaatgacttctggagatggaacaatatgagcggcatatacctgtacagcacgga--aaacataaga |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
44427406 |
tcagtaacaacctcttcatttgacgcaccctcggaaatgacttctggagatggaacaatatgagtggcatatacctgtacagcacggagaaaacataaga |
44427505 |
T |
 |
| Q |
99 |
tttgtaattttccatcccaaacaagcaacgatttgaacaatcagagatctcaaacttaaaagcggacaaagcaggattcatggtaagcaacatgaaaacc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44427506 |
tttgtaattttccatcccaaacaagcaacgatttgaactatcagagatctcaaacttaaaagcggacaaagcaggattcatggtaagcaacatgaaaacc |
44427605 |
T |
 |
| Q |
199 |
atgaatcatcattccaatctcttgtattcttgattcaacaagg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44427606 |
atgaatcatcattccaatctcttgtattcttgattcaacaagg |
44427648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University