View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_1D_low_38 (Length: 237)
Name: NF2258_1D_low_38
Description: NF2258_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_1D_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 15 - 92
Target Start/End: Original strand, 49007545 - 49007622
Alignment:
| Q |
15 |
catgggtaatattatcgaagtatctcatttattgatagcttaatcaataataaatacgaaagactttgtttagacata |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49007545 |
catgggtaatattatcgaagtatctcatttattgatagcttaatcaataataaatacgaaagactttgtttagacata |
49007622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 144 - 220
Target Start/End: Original strand, 40311393 - 40311469
Alignment:
| Q |
144 |
ctgctggcacaccttacataattattgatcaagatcgttgtcgtcatgagattgctaggatgatcattatgcatgat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311393 |
ctgctggcacaccttacataattattgatcaagatcgttgtcgtcatgagattgctaggatgatcattatgcatgat |
40311469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 144 - 220
Target Start/End: Original strand, 40296431 - 40296507
Alignment:
| Q |
144 |
ctgctggcacaccttacataattattgatcaagatcgttgtcgtcatgagattgctaggatgatcattatgcatgat |
220 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40296431 |
ctgcttgcacaccttacataatttttgatcaagatcgttgtcgtcatgagattgctaggatgatcattatgcatgat |
40296507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 49007671 - 49007741
Alignment:
| Q |
88 |
acataacccgccctttactaacaattaactaactttatct----taggtaataacagttgctgctggcaca |
154 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49007671 |
acataactcaccctttactaacaattaactaactttatctctaataggtaataacagttgctgctggcaca |
49007741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University