View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_1D_low_45 (Length: 222)
Name: NF2258_1D_low_45
Description: NF2258_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_1D_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 21 - 208
Target Start/End: Complemental strand, 36232260 - 36232073
Alignment:
| Q |
21 |
ctcatcaaacagctttgttactttattgcatcgagaaagatgagtaaactgttaaattgatcttggtctctttaaccactttcaaattagtcctgactct |
120 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| | |||||||||| ||||||||| ||| ||| |
|
|
| T |
36232260 |
ctcatcaaacagctttgttactttatttcatcgagaaagatgagtaaactgctaaattgatcttggtctttgtaaccacttttaaattagtcatgattct |
36232161 |
T |
|
| Q |
121 |
gacaatattttaaatttcaagtaactctatcttcgttaaaagttttttaattaagtcattgtaatttgtatgtttttaataagctatt |
208 |
Q |
| |
|
|| ||||||||||||||||| |||||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36232160 |
gataatattttaaatttcaaataactctatctttattaaaagtttttcaattagatcattgtaatttgtatgtttttaataagctatt |
36232073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University