View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_1D_low_47 (Length: 220)
Name: NF2258_1D_low_47
Description: NF2258_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_1D_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 33 - 146
Target Start/End: Original strand, 41957818 - 41957931
Alignment:
| Q |
33 |
ttattctatctggttagttaacgcaactctcattcagaaataaaatttaatctaaagtggcaaaatggaataatattcaacattaacttatcatatcctg |
132 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41957818 |
ttattctatctggttagttaacagagctctcattcagaaataaaatttaaactaaagtggcaaaatggaataatattcaacattaacttatcatatcctg |
41957917 |
T |
 |
| Q |
133 |
atgtccatctcatt |
146 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
41957918 |
atgtctgtctcatt |
41957931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University