View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_1D_low_48 (Length: 219)
Name: NF2258_1D_low_48
Description: NF2258_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_1D_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 13 - 122
Target Start/End: Original strand, 14590097 - 14590205
Alignment:
| Q |
13 |
tttggtgttgatgataataaagtacaaaagaaaaatttattttctcatgcttgttgcatgtgnnnnnnnnntattttaataaatttatccttttagcacg |
112 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14590097 |
tttggtatagatgataataaagtacaaaagaaaaatttattttctcatgcttgtttcatgtg-aaaaaaaatattttaataaatttatccttttagcacg |
14590195 |
T |
 |
| Q |
113 |
tgaagagatc |
122 |
Q |
| |
|
|||||||||| |
|
|
| T |
14590196 |
tgaagagatc |
14590205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University