View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_1D_low_54 (Length: 204)
Name: NF2258_1D_low_54
Description: NF2258_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_1D_low_54 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 14 - 204
Target Start/End: Complemental strand, 11619629 - 11619439
Alignment:
| Q |
14 |
aacagtaaataaaatttgtataaagactaaacatgaatggtggtgattttatattnnnnnnn-ctttcaataacaaactttctaatatgtaactgcaatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11619629 |
aacagtaaataaaatttgtataaagactaaacatgaatggtggtgattt-atattaaaaaaaactttcaataacaaactttctaatatgtaactgcaatt |
11619531 |
T |
 |
| Q |
113 |
cgttttaccacttgagtctagctcaagttgttgacacatcgagtgtgtgaatgttgtaaattttgaagtaccgagtttgattccttattaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11619530 |
cgttttaccacttgagtctagctcaagttgttgacacatcgagtgtgtgaatgttgtaaattttgaagtatcgagtttgattccttattaaa |
11619439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University